Esmolol reduces apoptosis and inflammation in early sepsis rats with abdominal infection
a b s t r a c t
Background: Esmolol is a highly selective beta 1 receptor blocker with various effects such as slowing heart rate, lowering blood pressure and reducing myocardial oxygen consumption. However, few studies have reported the use of beta blockers in sepsis with Multiple organ dysfunctions. This study aimed to investigate the effects of esmolol on reducing apoptosis and inflammation in early sepsis rats with abdominal infection.
Methods: Rats were randomly divided into sham operation group, sepsis group, antibiotic group, Esmolol + an- tibiotic group with low, median and high dose Esmolol (L group, M group and H group). Values between two or more groups were compared by independent t-tests.
Results: In the liver and kidney, we found inflammatory infiltration in sepsis group while pathological aspects re- duced in L, M and H groups. Bcl-2 mRNA and protein levels increased while Bax mRNA and protein levels de- creased in the liver and kidney of L, M and H groups. Serum IL-6, HMGB-1 and TNF-? levels decreased but IL- 10 level increased in L, M and H groups, compared to sepsis group. Compared to sepsis and antibiotic groups, the levels of myocardial enzymes were lower in L, M and H groups.
Conclusion: The administration of esmolol in early sepsis may reduce inflammation, inhibit apoptosis and protect key organs.
(C) 2017
Introduction
Sepsis is a systemic inflammatory response caused by infection and can lead to multiple organ dysfunction syndrome [1]. Severe sepsis induced by abdominal infection can develop rapidly with high mortality. Among abdominal organs, dysfunctions of the liver and kid- ney are commonly associated with abdominal infection and severe sep- sis [2]. In sepsis, the body can produce inflammatory factors, resulting in systemic inflammatory response that causes damage to abdominal or- gans as well as myocardial injury. Interleukin (IL-6, IL-10) and high mo- bility group protein B1 (HMGB-1) have been shown to play important role in the development of sepsis [3]. Current therapies for septic shock mainly include Sepsis Bundle such as early hemodynamics assess- ment, volume resuscitation, early application of broad spectrum antibi- otics and short-acting hormone, and blood purification [4]. However, there is no effective means to inhibit the inflammation or sequential multiple organ dysfunction caused by sepsis. It is also unclear whether
E-mail address: [email protected] (P. Zhang).
1 Yang Yang and Yang Lu contributed equally to this work and were co-first authors.
highly selective short-acting beta-1 blocking agents can block sympa- thetic activation and thus alleviate damage to systemic organs. Since beta-blockers may aggravate cardiovascular dysfunction and low blood pressure as well as other diseases, they have not yet been gener- ally used in patients with sepsis shock [5,6].
This study aimed to identify new agent that could relieve the inflam- mation and damage to vital organs of the body associated with sepsis. Esmolol is a highly selective beta 1 receptor blocker with various effects such as slowing heart rate, lowering blood pressure and reducing myo- cardial oxygen consumption. We established a model of sepsis in rats and investigated whether esmolol can alleviate the combined organ dysfunction caused by sepsis.
Materials and methods
Animals
A total of 55 male clean SD rats (weight 250-350 g) were purchased from the laboratory animal center of college of Life Sciences, Nankai University. The rats were randomly divided into a sham-operated
http://dx.doi.org/10.1016/j.ajem.2017.04.056
0735-6757/(C) 2017
control group (con group, 5 rats), sepsis group (CLP group,10 rats), an- tibiotic group(antibiotic group, 10 rats)and esmolol + antibiotic group, which was further divided into low dosage (L group), medium dosage (M group) and high dosage (H group) esmolol groups with 10 rats in each group. Esmolol and piperacillin/tazobactam were kindly provided by the Intensive Care Unit of Tianjin Medical University Cancer Institute and Hospital.
Establishment of animal model
cecal ligation and puncture (CLP) method was used to model sepsis in rats [7]. Briefly, 10% Chloral hydrate was injected at 0.6 ml/100 g for anesthesia and the rats were fixed, abdominal hair was removed for dis- infection. Then 1.5 cm incision was made at the midline of abdomen, find caecum, peel off mesentery using No. 4 surgical suture for ligation at the point 1/3 to the bottom of caecum, and the ligation of ileum and mesenteric vascular was avoided. Next, one-time puncture of cae- cum was made at 0.8-1.0 cm from ligation to far end, and the ligation of bilateral detachment of omentum majus. Finally, abdominal incision was sutured and rats received immediate subcutaneous injection of 3- 5 ml normal saline to prevent shock.
In Control group, rats were operated without cecal ligation and puncture. In CLP group, rats received no drug after CLP operation. In An- tibiotic group, rats received intravenous administration of 787.5 mg/Kg piperacillin/tazobactam one hour after CLP operation. In Esmolol + an- tibiotic group, the rats received intravenous administration of
787.5 mg/Kg piperacillin/tazobactam along with 1.75 mg/Kg/h esmolol (Low dosage Group), 2.6 mg/Kg/h esmolol (Medium dosage Group), and 3.5 mg/Kg/h esmolol (High dosage Group) one hour after CLP oper- ation till the end of the experiment.
Blood collection and analysis
4 ml blood was collected from the rats in each group 6 h and 24 h after the surgery. Half (2 mL) of each sample was added to an anticoagulation tube with heparin sodium, mixed and kept at 4 ?C for cardiac troponin (cTnI), creatine kinase (CK) and Lactate dehydrogenase tests. The remaining 2 ml of each sample was kept at room tem- perature for 2 h, centrifuged to obtain serum and kept at -80 ?C. Serum levels of IL-6, IL-10, HMGB-1 and TNF-? were detected using Enzyme- linked immunosorbent assay (ELISA) kits (Abcam, USA).
Analysis of the organs
All the rats were killed and the heart, livers, kidneys and lungs were dissected. Part of the organs was fixed in 4% formalin for hematoxylin and eosin (HE) staining and pathological analysis. The other part of the organs was lysed for Real-time PCR and Western blot analysis of Bcl-2 and Bax expression levels. Bcl-2, Bax and ?-actin antibodies were purchased from Sigma (St Louis, MO, USA). PCR primers and SYBR GREEN kit were purchased from Takara Bio Inc. Primer sequences were as follow: Bcl-2 GGGAGATCGTGATGAAGTAC and GGAAGGAGAAGATGCCAG; Bax GAGCTGCAGAGGATGATTG and CCCAGTTGAAGTTGCCATC; ?-actin GAACCCTAAGGCCAACCGTG and AGGCATACAGGGACAACACAGC.
Statistical analysis
Data were shown as average +- standard deviation. Data analysis was performed using the SPSS version 19.0 software (SPSS Inc., Chicago, IL, USA). Values between two or more groups were compared by inde- pendent t-tests. p b 0.05 indicated significant difference.
Results
Pathological examination of the organs
We collected rat heart, liver, lung, kidney specimens from the six groups. The sections were stained with HE, and inflammatory infiltra- tion was detected under a microscope. We found significant pathologi- cal aspects in the liver and kidney of CLP group but these aspects were reduced in Esmolol group (Fig. 1). However, we did not find significant differences in inflammatory infiltration in the heart and lung sections of different groups (Fig. 2), probably due to the Short duration between surgery and sacrifice.
Comparison of Bcl-2 and Bax expression in the liver and kidney
To understand the molecular mechanism underlying the pathologi- cal changes in the liver and kidney, we detected the expression of Bcl- 2 and Bax. Compared to Con group, Bcl-2 mRNA expression level in the liver increased gradually in CLP group, Antibiotic group, L group, M group and H group. Bax mRNA expression in CLP group was the
Fig. 1. Pathological analysis of the liver (A-C) and kidney (D-F). A: CLP Group, extensive hepatic ischemia, neutrophil infiltration in the hepatic sinus; B: Antibiotic Group, individual hepatic ischemia, liver sinus congestion; C: Antibiotics + Esmolol Group, normal hepatic lobule with central venous congestion. D: CLP Group, large number of tubular structures; E: Antibiotic Group, the structure of renal unit tube was less than that of sepsis group; F: Antibiotics + Esmolol Group, no nephron tubular structure. HE staining 200x.
Fig. 2. Pathological analysis of the heart (A-C) and lung (D-F). A,D: CLP Group; B,E: Antibiotic Group; C,F: Antibiotics + Esmolol Group. No obvious inflammatory cell infiltration was observed. HE staining 100x.
highest, then decreased gradually in Antibiotic group, L group, M group and H group. The ratio of Bcl-2/Bax increased gradually in Antibiotic group, L group, M group and H group (Fig. 3A). Similar results on Bcl-
2 and Bax mRNA expression and Bcl-2/Bax ratio were observed in the kidney, except that there were no significant differences in Bcl-2, Bax and Bcl-2/Bax ratio between M group and H group (Fig. 3B).
Fig. 3. Bcl-2 and Bax expression levels in the liver and kidney of each group. A: Bcl-2 and Bax mRNA expression levels in the liver. B: Bcl-2 and Bax mRNA expression levels in the kidney. C: Bcl-2 and Bax protein expression levels in the liver. D: Bcl-2 and Bax protein expression levels in the kidney. * p b 0.05.
Western blot analysis of Bcl-2 and Bax protein expression and Bcl-2/ Bax ratio in the liver and kidney in different groups showed similar changes to Bcl-2 and Bax mRNA expression (Fig. 3C and D). These data suggest that Esmolol inhibits sepsis induced apoptosis in the liver and kidney.
Comparison of inflammatory factor levels in blood samples 24 h after surgery
ELISA assay showed that serum IL-6, HMGB-1, TNF-? levels were the highest while IL-10 level was the lowest in CLP group at 24 h after sur- gery in rats. The levels of IL-6, HMGB-1 and TNF-? decreased but IL-10 level increased gradually in Antibiotic group, L group, M group and H group (Fig. 4A,B).These results indicate that esmolol inhibits sepsis in- duced inflammation in the liver and kidney.
Comparison of myocardial enzyme indexes in blood samples 6 and 24 h after surgery
Myocardial enzyme indexes including CK, LDH and cTnl were the highest in CLP group at 6 and 24 h after CLP surgery, but decreased grad- ually in Antibiotic group, L group, M group and H group (Fig. 4C,D,E). However, we observed no significant differences between M group and H group. These data suggest that low dose of Esmolol is sufficient to protect the heart after sepsis.
Discussion
Sepsis is a syndrome of systemic organ dysfunction induced by infec- tion. It is believed that sepsis is a complex reaction caused by wide- spread activation of the body defense by microorganisms and their products, including cytokine release, activation of immune cells, activa- tion of Endothelial cells and activation of cascade system of plasma pro- teins. Furthermore, a variety of signaling and neuroendocrine network are known to regulate sepsis [8].
Esmolol is a highly selective beta 1 receptor blocker that works mainly by inhibiting adrenergic receptors, slowing heartbeat, weaken- ing myocardial contractility, lowering blood pressure, decreasing myo- cardial oxygen consumption, preventing heart injuries caused by catecholamine and improving the reconstruction and function of left ventricle and blood vessel [9]. Beta blockers have long been regarded as forbidden drugs due to negative inotropic effect. However, beta blockers have recently been identified as being beneficial to chronic heart failure, they not only block sympathetic nerve excitation but also inhibit inflammatory cytokines and increase beta receptor density [10]. Morelli et al. reported the effects of esmolol on heart Rate control in sepsis shock patients [11]. Jacquet-Lagrezeet et al. found that esmolol had beneficial effects on heart rate in animal model [12]. Therefore, this study aimed to investigate whether the short-acting and highly selec- tive beta 1 receptor blocker esmolol could inhibit inflammatory re- sponse and protect main organs in addition to the heart. Furthermore, by applying different dosages of esmolol on sepsis animal models, we tried to find the most suitable dose of esmolol to reduce Adverse drug reactions.
Our results showed that CLP group had the highest amount of in- flammatory cells in the liver and the kidney. Among the groups receiv- ing different doses of esmolol, we did not see significant differences in inflammatory cell infiltration in L, M and H groups. This might be be- cause the short duration of sepsis had no severe effects on the organs. In addition, we found no significant differences in inflammatory infiltra- tion in the heart and lung perhaps these organs have some compensato- ry ability.
Bcl-2 family members play a key role in the regulation of apoptosis caused by different stimulatory signals. Increased levels of Bax promote apoptosis while increased Bcl-2 levels inhibit apoptosis [13,14]. In our study, mRNA and protein expression levels of Bcl-2 increased gradually while those of Bax decreased in CLP, antibiotic, L, M and H groups, there- by increasing Bcl-2/Bax ratio. Thus the rats in the CLP group with the most severe infection had the highest rate of apoptosis, while models in the antibiotic group had less apoptosis compared to CLP group, and apoptosis was further reduced in esmolol groups.
Fig. 4. Serum inflammatory factors levels and myocardial enzyme levels of each group. A: Serum levels of IL-6, HMGB-1 and TNF-?. B: Serum IL-10 levels. C: CK levels. D: LDH levels. E: cTnl levels. * p b 0.05.
Furthermore, we determined the difference in inflammatory factors among the different groups. IL-6 and TNF-? are key pro-inflammatory factors, whose levels could increase sharply during severe infection [15]. High mobility group box-1 protein (HMGB1) is an important in- flammatory mediator of the lethal effects of endotoxins [16]. IL-10 is an important anti-inflammatory cytokine and can inhibit Th1 type im- mune response by inhibiting the proliferation of Th1 cells and the pro- duction of cytokines such as IL-2, IFN and leukotriene [17]. In this study we found that the level of HMGB-1 and IL-6 were the highest and IL-10 level was the lowest in CLP group, consistent with the highest extent of damages in this group. With application of antibiotics and esmolol, the levels of IL-6 and HMGB-1 decreased while IL-10 level in- creased. These data suggest that beta 1-blockers may reduce inflamma- tion caused by infection.
Finally, we compared changes in myocardial enzymes in different groups at 6 h and 24 h after CLP. Compared to control group, myocardial enzymes in the other five groups significantly increased and the level of myocardial enzymes at 24 h were higher than that at 6 h. However, the levels of myocardial enzymes decreased in Esmolol groups, which indi- cates that Esmolol has a protective effect on the heart in sepsis model. Notably, we found no significant differences in myocardial enzymes be- tween M and H groups, which suggests that low dose of Esmolol is suf- ficient to offer myocardial protection.
Taken together, our results suggest that applying beta 1 blocker Esmolol in early sepsis animal models may reduce apoptosis and in- flammatory reaction and thus help protect key organs, and
2.6 mg/Kg/h of Esmolol may be the appropriate and safe dosage. Further
clinical trials are needed to confirm that Esmolol can be used in the treatment of sepsis.
Conflict of interest
The authors declare that they have no competing interests.
The study was supported by a grant from Science and technology fund of Tianjin Municipal Health Bureau, China (No. 2013KZ091) and the Science Foundation of Tianjin Medical University, China (No. 2014KYQ10).
References
- Hotchkiss RS, Karl IE. The pathophysiology and treatment of sepsis. N Engl J Med 2003;348:138-50.
- Sapin F, Biston P, Piagnerelli M. Predictive value of C-reactive protein in critically ill patients after abdominal surgery. Clinics (Sao Paulo) 2017;72:23-9.
- Oberholzer A, Souza SM, Tschoeke SK, Oberholzer C, Abouhamze A, Pribble JP, et al. Plasma cytokine measurements augment Prognostic scores as indicators of outcome in patients with severe sepsis. Shock 2005;23:488-93.
- Dellinger RP, Levy MM, Rhodes A, Annane D, Gerlach H, Opal SM, et al. Surviving sepsis campaign: international guidelines for management of severe sepsis and sep- tic shock, 2012. Intensive Care Med 2013;39:165-228.
- Papanikolaou J, Makris D, Tsolaki V, Spathoulas K, Zakynthinos E. Post-partum hem- orrhage complicated by reverse-Takotsubo cardiogenic shock; a novel therapeutic approach. Am J Emerg Med 2017;35:935.e1-3.
- Wei C, Louis H, Schmitt M, Albuisson E, Orlowski S, Levy B, et al. Effects of low doses of esmolol on cardiac and vascular function in experimental septic shock. Crit Care 2016;20:407.
- Rittirsch D, Huber-Lang MS, Flierl MA, Ward PA. Immunodesign of experimental sepsis by cecal ligation and puncture. Nat Protoc 2009;4:31-6.
- Sha T, Iizawa Y, Ii M. Combination of imipenem and TAK-242, a toll-like receptor 4 signal transduction inhibitor, improves survival in a murine model of polymicrobial sepsis. Shock 2011;35:205-9.
- Ponikowski P, Voors AA, Anker SD, Bueno H, Cleland JG, Coats AJ, et al. ESC guidelines for the diagnosis and treatment of acute and chronic heart failure. Rev Esp Cardiol 2016;2016(69):1167 (Engl Ed).
- Ibrahim-Zada I, Rhee P, Gomez CT, Weller J, Friese RS. Inhibition of sepsis-induced inflammatory response by ?1-adrenergic antagonists. J Trauma Acute Care Surg 2014;76:320-7.
- Morelli A, Ertmer C, Westphal M, Rehberg S, Kampmeier T, Ligges S, et al. Effect of Heart rate control with esmolol on hemodynamic and clinical outcomes in patients with septic shock: a randomized clinical trial. JAMA 2013;310:1683-91.
- Jacquet-Lagreze M, Allaouchiche B, Restagno D, Paquet C, Ayoub JY, Etienne J, et al. Gut and sublingual microvascular effect of esmolol during septic shock in a porcine model. Crit Care 2015;19:241.
- Fu H, Wang QS, Luo Q, Tan S, Su H, Tang SL, et al. Simvastatin inhibits apoptosis of endothelial cells induced by sepsis through upregulating the expression of Bcl-2 and downregulating Bax. World J Emerg Med 2014;5:291-7.
- Bilbault P, Lavaux T, Lahlou A, Uring-Lambert B, Gaub MP, Ratomponirina C, et al. Transient Bcl-2 gene down-expression in circulating mononuclear cells of severe sepsis patients who died despite appropriate intensive care. Intensive Care Med 2004;30:408-15.
- Huo R, Wang L, Wang X, Zhao Y, Wang Y, Zhao X, et al. Removal of regulatory T cells prevents secondary chronic infection but increases the mortality of subsequent sub- Acute infection in sepsis mice. Oncotarget 2016;7:10962-75.
- Slotwinski R, Sarnecka A, Dabrowska A, Kosalka K, Wachowska E, Balan BJ, et al. In- nate immunity gene expression changes in critically ill patients with sepsis and dis- ease-related malnutrition. Cent Eur J Immunol 2015;40:311-24.
- Kang H, Mao Z, Zhao Y, Yin T, Song Q, Pan L, et al. Ethyl pyruvate protects against sepsis by regulating Energy metabolism. Ther Clin Risk Manag 2016;12:287-94.
